ID: 911920475

View in Genome Browser
Species Human (GRCh38)
Location 1:103754142-103754164
Sequence TCATTTAGAGGCACTCCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911920475_911920477 1 Left 911920475 1:103754142-103754164 CCTTCTGGAGTGCCTCTAAATGA No data
Right 911920477 1:103754166-103754188 AATGTGCTGAAACCTCTGAAAGG 0: 6
1: 0
2: 0
3: 15
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911920475 Original CRISPR TCATTTAGAGGCACTCCAGA AGG (reversed) Intronic