ID: 911920565

View in Genome Browser
Species Human (GRCh38)
Location 1:103755537-103755559
Sequence CTGTGTGACTCATAGGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 3, 1: 3, 2: 0, 3: 10, 4: 193}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911920565 Original CRISPR CTGTGTGACTCATAGGAAGG AGG (reversed) Intronic
900870949 1:5302342-5302364 CTGTGTGGCACAGTGGAAGGAGG - Intergenic
903346680 1:22689598-22689620 CTGTGTGACTCATGGAAAACAGG + Intergenic
903553595 1:24176853-24176875 CTTTGTGAGGCATAGGTAGGAGG - Intronic
904032556 1:27542377-27542399 CTGTGCTCCTCCTAGGAAGGAGG - Intronic
904508682 1:30982441-30982463 CAGTATGACTCCTTGGAAGGAGG - Intronic
906794581 1:48687020-48687042 CAGTGAAACTCATAGGGAGGGGG + Intronic
908488969 1:64623987-64624009 CTAACTGACTCATAGGAATGGGG + Intronic
910772425 1:90843586-90843608 CTGTATTAATAATAGGAAGGGGG + Intergenic
911590353 1:99740686-99740708 CTTTGTGACTCCAAGGCAGGAGG + Intronic
911906548 1:103576249-103576271 CTGTGTGACTCAGAGGAAGGAGG - Intronic
911910054 1:103622622-103622644 CCGTGTGACTCATAGGAAGGAGG - Intronic
911913152 1:103661399-103661421 CTGTGTGACTCATAGGAAGGAGG - Intronic
911915302 1:103690549-103690571 CTGTGTGACTCATAGGAAGGAGG + Intronic
911917470 1:103716747-103716769 CCGTGTGACTCATAGGAAGGAGG - Intronic
911920565 1:103755537-103755559 CTGTGTGACTCATAGGAAGGAGG - Intronic
912522897 1:110258627-110258649 CTGTGTGAATGATTTGAAGGAGG - Intronic
914920630 1:151844944-151844966 CTCTGAGACTGAAAGGAAGGAGG - Intergenic
917469688 1:175315840-175315862 GTGTGTGAATGATTGGAAGGAGG + Exonic
918327545 1:183424764-183424786 TTGGGTGACTTAAAGGAAGGAGG - Intergenic
918726266 1:187928439-187928461 CTGTGTTTCTCAGAGGAATGAGG + Intergenic
920687019 1:208117209-208117231 CTGTGTGAATTATTGGAGGGAGG + Intronic
921180492 1:212627986-212628008 CTGTCTGAGACATGGGAAGGAGG + Intergenic
921426653 1:215010509-215010531 CTGTTTCTCTCATAGGAGGGAGG - Intronic
921761419 1:218919465-218919487 CTGTGTGGCTGAGAGGCAGGAGG - Intergenic
923082222 1:230668923-230668945 ATGTGTGACACTTAGGAAGCTGG - Intronic
923221243 1:231896093-231896115 CGATGAAACTCATAGGAAGGGGG - Intronic
923859535 1:237879397-237879419 ATGTATGACTCACAAGAAGGTGG - Intronic
924657945 1:245990438-245990460 CTGTGTGACCAAAAGGAAGTAGG - Intronic
924866837 1:247991984-247992006 GTGAGTGACTGATAGGAAGTTGG + Intronic
1063876283 10:10482786-10482808 CTGTGTGAGTTAGATGAAGGGGG - Intergenic
1064288319 10:14011763-14011785 CTTTGGGACTCAGAGGTAGGTGG + Intronic
1064524075 10:16234863-16234885 ATGAGTAACTGATAGGAAGGAGG + Intergenic
1064568140 10:16664352-16664374 CTGTGTGACTCTTAGGTATGTGG + Intronic
1067708391 10:48628009-48628031 CTCTGAGACTCAAAGAAAGGAGG + Intronic
1068685108 10:59862241-59862263 CTGTGTGACCCCGAGGCAGGTGG + Intronic
1069070834 10:63989105-63989127 CTGTGTGAGTCCTGTGAAGGGGG - Intergenic
1069950503 10:72015113-72015135 CTGGGTGAGTCAAAGGAAAGCGG - Intergenic
1070825621 10:79388789-79388811 CTGTGCCACTCACAGGGAGGTGG - Intronic
1072610989 10:97017627-97017649 CAGTGTGACTCATGAGATGGGGG + Intronic
1075225473 10:120624952-120624974 CTGTGTGGCTCATCGGGAAGAGG + Intergenic
1078437916 11:11340723-11340745 CTGGCTGACCCATAGGAAGAAGG + Intronic
1081761068 11:45576714-45576736 CTTGGTGACTGATAGGAAGTGGG + Intergenic
1082781081 11:57287906-57287928 ATGTGTGACACTTAGGAAGTGGG - Intergenic
1084644777 11:70449588-70449610 CAGGGTCACTCAGAGGAAGGAGG + Intergenic
1086740064 11:90355773-90355795 CTGTGTCACTCTAAGGAAAGAGG + Intergenic
1086978651 11:93167827-93167849 CTGTGTGCCACATATGAAGTAGG + Intronic
1089829100 11:121309409-121309431 CTGTGTGCCTGGGAGGAAGGGGG + Intergenic
1090223540 11:125053296-125053318 CTGTATGACACACAGGAAGTGGG + Intergenic
1091967517 12:4757175-4757197 CTGGGTAACTTATAGGAAAGAGG - Intronic
1092148571 12:6231711-6231733 CTGAGTGGCTCATGGAAAGGAGG - Intronic
1094215622 12:27939117-27939139 CTTTGGGACTCAAAGGTAGGAGG + Intergenic
1095742622 12:45623477-45623499 CTGTGGGATACATAGGAAGGAGG + Intergenic
1096342894 12:50817154-50817176 CTGTGTGACTGAGAGGAACTTGG + Intronic
1098850062 12:75585535-75585557 CTAAGTGACTCATAGGCTGGTGG - Intergenic
1102419996 12:112795981-112796003 CTGTATGACTCACAAGAGGGAGG + Intronic
1103559414 12:121785154-121785176 CTGACTGACTCACAGGCAGGTGG + Intronic
1104391181 12:128391716-128391738 CTGTGTGACCTAAAGCAAGGAGG - Intronic
1104781240 12:131421933-131421955 CTGAGGGACTCATAGGAGTGAGG - Intergenic
1105899118 13:24741399-24741421 ATGAGTGACTCACGGGAAGGAGG + Intergenic
1107152895 13:37132404-37132426 CTAAGTGACTCACAGGCAGGTGG - Intergenic
1107377065 13:39815516-39815538 CTGTTTAAATCATAGGCAGGGGG + Intergenic
1108173004 13:47762656-47762678 CAGTGTGGCTCTTAGGAAGTAGG + Intergenic
1112729266 13:102341680-102341702 CTGTCTTATTCATAGGAAGAAGG - Intronic
1112764852 13:102730109-102730131 TTGTGGGACTTACAGGAAGGTGG + Exonic
1113307129 13:109090674-109090696 CTGTCAGAATCATGGGAAGGAGG + Intronic
1115645317 14:35365290-35365312 TTGTGTGACCCATGGGAGGGAGG - Intergenic
1116938168 14:50763444-50763466 GTGTGTAACTCATATGAAGATGG - Intronic
1117349390 14:54866642-54866664 CTGAGTGAGTCACAGGAAGATGG + Intronic
1124898054 15:33795871-33795893 ATTTCTGACTCCTAGGAAGGAGG - Intronic
1125727107 15:41873760-41873782 CTGTGGGACTCTCAGGGAGGCGG - Intronic
1126718231 15:51546147-51546169 CTGTTTGGGTTATAGGAAGGAGG - Intronic
1127892691 15:63269262-63269284 CTGTGAGACCAAGAGGAAGGAGG - Intergenic
1129532595 15:76280770-76280792 CTATTTGACGAATAGGAAGGAGG - Intronic
1129675405 15:77630577-77630599 CTGTGTGACTGGGAGGGAGGTGG - Intronic
1129751387 15:78067198-78067220 CTGTATCACACATGGGAAGGGGG + Intronic
1132220501 15:100101622-100101644 CTGTGTGTGTCAGAGGATGGGGG - Intronic
1133098093 16:3461239-3461261 TTGTGGGAGTGATAGGAAGGGGG + Intronic
1137721188 16:50628408-50628430 CTGTGGGACTTACAGGCAGGAGG + Intronic
1138262225 16:55632089-55632111 CTGTGTGAGTCCTGTGAAGGAGG - Intergenic
1138744519 16:59347882-59347904 ATGTGTGACTCATTTGAAAGAGG + Intergenic
1141476087 16:84274411-84274433 CTGGGTGACGAATGGGAAGGTGG - Intergenic
1143053648 17:4146336-4146358 CTGTGTGAGACCTAGGCAGGTGG - Intronic
1144725167 17:17498223-17498245 CTGTGGGAGGCACAGGAAGGCGG - Intergenic
1146601815 17:34223917-34223939 CTGTGTGAGTAATAGCAAGTGGG - Intergenic
1148003279 17:44403460-44403482 CTTTGTGACACAGAGGCAGGAGG - Intronic
1148442446 17:47718481-47718503 CTGAGTGACAGAGAGGAAGGAGG - Intergenic
1148659549 17:49317713-49317735 CTGTGTGGCTCATTGGTAAGTGG + Exonic
1151486385 17:74403689-74403711 CTGGGAGGCTCAGAGGAAGGAGG - Intergenic
1159522717 18:69546898-69546920 CTGGGTAATTCATAAGAAGGAGG + Intronic
1160097724 18:75890510-75890532 CTGTGTGTGTCTTAGAAAGGTGG - Intergenic
1162527797 19:11216779-11216801 CTGTGGGACTGAGAGGAAAGGGG - Intronic
1162623718 19:11865782-11865804 CTTTGTGACTCTGAGGCAGGTGG + Intronic
1163340522 19:16703535-16703557 CTTTGTGAGGCAGAGGAAGGAGG + Intergenic
1163599602 19:18240948-18240970 CTGTGTGACTCCCAGCAAGCAGG - Intronic
925085237 2:1102485-1102507 CTGCGTGTCTGAGAGGAAGGAGG + Intronic
925942035 2:8830066-8830088 CTGTGTGACTCAGAGGGAGATGG - Intronic
928986802 2:37190006-37190028 CAGTGTGAGTCATGGGAGGGTGG - Intronic
931799734 2:65747224-65747246 CTGTGTGTCTCTCAGGGAGGGGG + Intergenic
932413926 2:71562638-71562660 CTGTGGGACTCCCAGGGAGGAGG + Intronic
932434355 2:71694547-71694569 CTGTGTGGGTCTGAGGAAGGTGG - Intergenic
932683880 2:73851457-73851479 CTGTGGAATTCAGAGGAAGGAGG + Intronic
935687877 2:105700297-105700319 CTGTGGAGCTCACAGGAAGGAGG - Intergenic
935830302 2:106995238-106995260 CTGTCTGGCTCATAGTAACGTGG - Intergenic
935948466 2:108307272-108307294 CTGTGTGAGTCTGAAGAAGGAGG - Intronic
937109757 2:119355557-119355579 CTGTGGGACCTATAGGGAGGAGG + Intronic
937289317 2:120772540-120772562 CTGGCTGAGTGATAGGAAGGAGG + Intronic
939715272 2:145576099-145576121 CCGTGTTTCTCATAGGAAAGAGG + Intergenic
939885408 2:147676093-147676115 CTGTGAGAGTCAAAGGAAGCTGG - Intergenic
941677373 2:168357850-168357872 CTGTGTGAGGCCAAGGAAGGAGG - Intergenic
942130273 2:172871913-172871935 CTGTGTGACTCCAAGCAAGTTGG - Intronic
946452815 2:219795511-219795533 CTGTGTGAATGATAAGAGGGAGG - Intergenic
946486956 2:220109974-220109996 CTGGGAGACTCAAAGGCAGGGGG - Intergenic
948859863 2:240747553-240747575 CTTTGTGACTCCTATCAAGGTGG - Intronic
1168978621 20:1986593-1986615 CTGTGTGTCTTATTGTAAGGGGG + Intronic
1169666808 20:8046762-8046784 CTTTGTGAATGAAAGGAAGGAGG - Intergenic
1169827520 20:9785936-9785958 GTGTCTGACTGATAGGCAGGTGG - Intronic
1170142406 20:13138071-13138093 CTGAGTAACTCACAGGAAAGGGG - Intronic
1172331418 20:34078490-34078512 CTGTGTTCCTGATAGGGAGGAGG - Exonic
1172578810 20:36030732-36030754 CTGTGGGACTTGGAGGAAGGGGG + Intergenic
1173113887 20:40222012-40222034 CAGAGTTACTCATAGGAAGTTGG - Intergenic
1176611725 21:8990165-8990187 GTGGGTGACTCATGGAAAGGAGG + Intergenic
1176645753 21:9347835-9347857 CTGTGTGAGTCCAAGGGAGGTGG + Intergenic
1182186464 22:28408132-28408154 CTGTGCAACTCTTAGGAAGTCGG - Intronic
1182944504 22:34309060-34309082 ATGTGTAATTCATAGGGAGGTGG + Intergenic
949097732 3:106015-106037 TTGTTTGAGACATAGGAAGGAGG - Intergenic
949770382 3:7571048-7571070 CTGTGTGAAGCATAGGAAATTGG - Intronic
953108244 3:39907006-39907028 CTGTGTGACTCAGATAGAGGAGG + Intronic
953393686 3:42549481-42549503 CTGTGTGAGGCACAGGAAGCAGG - Intronic
953634890 3:44654463-44654485 CTGCCTGACACATAGGAAGGAGG - Intronic
955520767 3:59773329-59773351 CTGTGGGAGTCACAGAAAGGGGG + Intronic
956279861 3:67544656-67544678 CTGTGAGACTTCTAGGAAGATGG + Intronic
957620689 3:82590002-82590024 CTGTCTGGCACATAGGAAGCAGG - Intergenic
959957010 3:112251251-112251273 CTGTGTCACTCCTAGGTGGGTGG - Intronic
967852314 3:194091404-194091426 CTAGGTGACTCATGGGATGGTGG - Intergenic
969535052 4:7751461-7751483 CTGTGTAACTTATAAGAAAGAGG + Intergenic
973117629 4:46480697-46480719 ATATGTGACTCATAGGAACATGG + Intergenic
973321569 4:48816101-48816123 CTGTGTGACTAGCAGGAAGAAGG - Intronic
975487523 4:74950416-74950438 CAGAGTGACTCAGAGGAAAGGGG - Intronic
975655230 4:76634801-76634823 TTGTGTGACTTAGAGGAAGAAGG + Intronic
976804218 4:89027785-89027807 CTAAGTGACTAATAGGAAGGTGG + Intronic
978040200 4:104051122-104051144 AGGTGTGAATCAAAGGAAGGAGG - Intergenic
978705436 4:111703760-111703782 TTGTATGACTCAGAGGAAGAGGG + Intergenic
979410958 4:120379021-120379043 CTGAGTCAATCAAAGGAAGGAGG + Intergenic
981014696 4:139961594-139961616 CTTTCTGGCTCATAGGAATGCGG - Intronic
981690168 4:147499297-147499319 CTTTGTGAAGCAGAGGAAGGAGG - Intronic
986084090 5:4425670-4425692 CTGTGTAACACAAAGGAATGAGG + Intergenic
986405860 5:7424380-7424402 CTGTGTGACTTTGAGGAAGTTGG - Intronic
988070774 5:26285410-26285432 CTGTGTGACTCCTAGGGACTTGG - Intergenic
990516328 5:56534253-56534275 CTGAGTGACTCATCTGCAGGAGG - Intronic
992565184 5:77988931-77988953 CTGTCTGACTCTGAGCAAGGTGG + Intergenic
993049441 5:82909705-82909727 CTTTATCATTCATAGGAAGGAGG + Intergenic
994648221 5:102496254-102496276 CTGGTTGACTCACAGGAAGCAGG + Intronic
996148505 5:120005815-120005837 CTGTGTTACTCAAAGAAAGGTGG + Intergenic
998620526 5:143789531-143789553 CTGTTTGAAGCATAGAAAGGAGG - Intergenic
1001569217 5:172719167-172719189 CTTTTTGACCCACAGGAAGGAGG + Intergenic
1001632029 5:173182563-173182585 CTGTGTGCCTTATTGGAAGAGGG + Intergenic
1003260773 6:4513484-4513506 CTGTTTGAATCATAGATAGGCGG - Intergenic
1003662920 6:8080462-8080484 GTGTGTGACTCAGATGAAGGAGG + Intronic
1007316627 6:40994456-40994478 CTGTGAGACTGATAGGGAAGAGG - Intergenic
1009918649 6:70028521-70028543 CTGTTAGATTCCTAGGAAGGGGG + Intronic
1012046628 6:94283800-94283822 CTGGGTGATCCATAGGAAGCAGG - Intergenic
1013609690 6:111782844-111782866 CTGTGAGACTGATGGGAAGCTGG - Intronic
1015218769 6:130780624-130780646 CAGTGTGACCTATAGGAAGATGG + Intergenic
1017769217 6:157632046-157632068 CTGTGGGACTCAGTGGCAGGGGG - Intronic
1019102707 6:169644662-169644684 CAGTGTGACTCATATGAACTAGG - Intronic
1019102808 6:169645651-169645673 CAGTGTGACTCATATGAACTAGG - Intronic
1019102812 6:169645712-169645734 CAGTGTGACTCATATGAACTAGG - Intronic
1019304669 7:327586-327608 ATGAGAGACTGATAGGAAGGTGG + Intergenic
1019852811 7:3576337-3576359 CTGTGTGACTCTGAGCTAGGTGG + Intronic
1020913628 7:14164928-14164950 CTTTGTGACTCGTAGGTAGCAGG + Intronic
1020985275 7:15126095-15126117 ATGTGTGTCTCATCTGAAGGAGG - Intergenic
1021512965 7:21454599-21454621 CTGTGTGAGTCCTATGAAGGGGG + Intronic
1022044125 7:26609893-26609915 CTAAGTGCCTCATAGAAAGGAGG + Intergenic
1022214289 7:28243108-28243130 CAAGGTCACTCATAGGAAGGTGG + Intergenic
1023069444 7:36414428-36414450 CTGTGTGACGAAAAGGAAGGAGG + Intronic
1024405683 7:48976593-48976615 CAGTCTGACTCTGAGGAAGGTGG - Intergenic
1026367902 7:69667812-69667834 CTGTGGGCCTCAGAGGTAGGAGG - Intronic
1026589295 7:71681518-71681540 CTGTGGGTATCCTAGGAAGGTGG - Intronic
1027207802 7:76116224-76116246 CTGTGTGTTTCATAGTTAGGTGG - Intergenic
1027793540 7:82662213-82662235 CTGGGTGGCTTACAGGAAGGTGG - Intergenic
1028635872 7:92988809-92988831 CTGTGTGAATTATAGTATGGGGG + Intergenic
1029312370 7:99679204-99679226 AGGAGTGACTCATAGGAGGGAGG + Intronic
1030089104 7:105841571-105841593 CTAAGTGACTGATAGGCAGGTGG - Intronic
1031376418 7:121032454-121032476 CTGCGTGTCTCATAAGTAGGAGG + Intronic
1033047843 7:137978692-137978714 CTGGGTGAATGAGAGGAAGGGGG + Intronic
1035615454 8:996888-996910 CAGTGTGACTTGTGGGAAGGTGG - Intergenic
1035907147 8:3525690-3525712 CTGAGTGGTTCATAGGAAGCTGG - Intronic
1036185687 8:6620759-6620781 CTGTTTGACTCAGAGGACCGCGG - Intronic
1036389293 8:8310663-8310685 ATGTGTGACTCATAGTTGGGAGG + Intergenic
1036923428 8:12880504-12880526 CTGAGTGACTGATAGAAAGTAGG - Intergenic
1037412183 8:18609927-18609949 CTGTGTGACTCATAGCCCAGTGG - Intronic
1039190759 8:34971602-34971624 CTGTGTCACTTACAGGAAGAAGG - Intergenic
1044423117 8:92021678-92021700 CTCTGTCCCTCATAGGAATGTGG + Intronic
1044680402 8:94772234-94772256 CTGTGTGCTTCTGAGGAAGGGGG - Intronic
1046228942 8:111327551-111327573 CTGTGTTACTCAAAGGAATAAGG - Intergenic
1046728736 8:117702509-117702531 CTGTCTGCCTTCTAGGAAGGTGG - Intergenic
1047204948 8:122795474-122795496 CTATGTGCCACAAAGGAAGGTGG - Intronic
1048120769 8:131579082-131579104 GTGTGTGACTGTTAAGAAGGAGG + Intergenic
1051897677 9:22005842-22005864 GTCTGAGACTCACAGGAAGGAGG - Exonic
1053458948 9:38253532-38253554 CTTTGTGACTCTGAGGCAGGTGG + Intergenic
1056182907 9:84102680-84102702 CTGTGTGCCTTTTTGGAAGGCGG + Intergenic
1059697748 9:116744880-116744902 CTGTGAGACCCACAGGAAGATGG + Intronic
1060423047 9:123483234-123483256 CTGCTGGACTCTTAGGAAGGAGG - Intronic
1061487651 9:130928516-130928538 CTGGGTGACTGATGGGAAGGTGG - Intronic
1186779283 X:12897101-12897123 TTGTGAGAAGCATAGGAAGGAGG + Intergenic
1194296050 X:92127829-92127851 TTATGTGACTCTTAGAAAGGGGG - Intronic
1199844396 X:151680276-151680298 TTGGGTGACTCAGAGGATGGAGG - Intergenic
1199953925 X:152727452-152727474 CTGTGTGTCTCAAAGGTTGGGGG - Intergenic
1199974340 X:152884095-152884117 CTGGCTGTCTCATGGGAAGGGGG + Intergenic