ID: 911925789

View in Genome Browser
Species Human (GRCh38)
Location 1:103830776-103830798
Sequence CTGCTTGTGGGAGCCAGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911925789_911925799 23 Left 911925789 1:103830776-103830798 CCCACCCTGGCTCCCACAAGCAG No data
Right 911925799 1:103830822-103830844 ATACACAACTGCCTGCCAAGGGG No data
911925789_911925800 27 Left 911925789 1:103830776-103830798 CCCACCCTGGCTCCCACAAGCAG No data
Right 911925800 1:103830826-103830848 ACAACTGCCTGCCAAGGGGCTGG No data
911925789_911925798 22 Left 911925789 1:103830776-103830798 CCCACCCTGGCTCCCACAAGCAG No data
Right 911925798 1:103830821-103830843 CATACACAACTGCCTGCCAAGGG No data
911925789_911925795 -5 Left 911925789 1:103830776-103830798 CCCACCCTGGCTCCCACAAGCAG No data
Right 911925795 1:103830794-103830816 AGCAGCCTGCAAACTGCTTCAGG No data
911925789_911925801 30 Left 911925789 1:103830776-103830798 CCCACCCTGGCTCCCACAAGCAG No data
Right 911925801 1:103830829-103830851 ACTGCCTGCCAAGGGGCTGGTGG No data
911925789_911925797 21 Left 911925789 1:103830776-103830798 CCCACCCTGGCTCCCACAAGCAG No data
Right 911925797 1:103830820-103830842 ACATACACAACTGCCTGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911925789 Original CRISPR CTGCTTGTGGGAGCCAGGGT GGG (reversed) Intergenic
No off target data available for this crispr