ID: 911925790

View in Genome Browser
Species Human (GRCh38)
Location 1:103830777-103830799
Sequence GCTGCTTGTGGGAGCCAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911925790_911925799 22 Left 911925790 1:103830777-103830799 CCACCCTGGCTCCCACAAGCAGC No data
Right 911925799 1:103830822-103830844 ATACACAACTGCCTGCCAAGGGG No data
911925790_911925801 29 Left 911925790 1:103830777-103830799 CCACCCTGGCTCCCACAAGCAGC No data
Right 911925801 1:103830829-103830851 ACTGCCTGCCAAGGGGCTGGTGG No data
911925790_911925800 26 Left 911925790 1:103830777-103830799 CCACCCTGGCTCCCACAAGCAGC No data
Right 911925800 1:103830826-103830848 ACAACTGCCTGCCAAGGGGCTGG No data
911925790_911925798 21 Left 911925790 1:103830777-103830799 CCACCCTGGCTCCCACAAGCAGC No data
Right 911925798 1:103830821-103830843 CATACACAACTGCCTGCCAAGGG No data
911925790_911925795 -6 Left 911925790 1:103830777-103830799 CCACCCTGGCTCCCACAAGCAGC No data
Right 911925795 1:103830794-103830816 AGCAGCCTGCAAACTGCTTCAGG No data
911925790_911925797 20 Left 911925790 1:103830777-103830799 CCACCCTGGCTCCCACAAGCAGC No data
Right 911925797 1:103830820-103830842 ACATACACAACTGCCTGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911925790 Original CRISPR GCTGCTTGTGGGAGCCAGGG TGG (reversed) Intergenic