ID: 911925794

View in Genome Browser
Species Human (GRCh38)
Location 1:103830789-103830811
Sequence AGCAGTTTGCAGGCTGCTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911925794_911925800 14 Left 911925794 1:103830789-103830811 CCACAAGCAGCCTGCAAACTGCT No data
Right 911925800 1:103830826-103830848 ACAACTGCCTGCCAAGGGGCTGG No data
911925794_911925797 8 Left 911925794 1:103830789-103830811 CCACAAGCAGCCTGCAAACTGCT No data
Right 911925797 1:103830820-103830842 ACATACACAACTGCCTGCCAAGG No data
911925794_911925799 10 Left 911925794 1:103830789-103830811 CCACAAGCAGCCTGCAAACTGCT No data
Right 911925799 1:103830822-103830844 ATACACAACTGCCTGCCAAGGGG No data
911925794_911925798 9 Left 911925794 1:103830789-103830811 CCACAAGCAGCCTGCAAACTGCT No data
Right 911925798 1:103830821-103830843 CATACACAACTGCCTGCCAAGGG No data
911925794_911925801 17 Left 911925794 1:103830789-103830811 CCACAAGCAGCCTGCAAACTGCT No data
Right 911925801 1:103830829-103830851 ACTGCCTGCCAAGGGGCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911925794 Original CRISPR AGCAGTTTGCAGGCTGCTTG TGG (reversed) Intergenic
No off target data available for this crispr