ID: 911925795

View in Genome Browser
Species Human (GRCh38)
Location 1:103830794-103830816
Sequence AGCAGCCTGCAAACTGCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911925790_911925795 -6 Left 911925790 1:103830777-103830799 CCACCCTGGCTCCCACAAGCAGC No data
Right 911925795 1:103830794-103830816 AGCAGCCTGCAAACTGCTTCAGG No data
911925789_911925795 -5 Left 911925789 1:103830776-103830798 CCCACCCTGGCTCCCACAAGCAG No data
Right 911925795 1:103830794-103830816 AGCAGCCTGCAAACTGCTTCAGG No data
911925791_911925795 -9 Left 911925791 1:103830780-103830802 CCCTGGCTCCCACAAGCAGCCTG No data
Right 911925795 1:103830794-103830816 AGCAGCCTGCAAACTGCTTCAGG No data
911925787_911925795 26 Left 911925787 1:103830745-103830767 CCTATATTTTTGGAGGACAGGAT No data
Right 911925795 1:103830794-103830816 AGCAGCCTGCAAACTGCTTCAGG No data
911925792_911925795 -10 Left 911925792 1:103830781-103830803 CCTGGCTCCCACAAGCAGCCTGC No data
Right 911925795 1:103830794-103830816 AGCAGCCTGCAAACTGCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911925795 Original CRISPR AGCAGCCTGCAAACTGCTTC AGG Intergenic
No off target data available for this crispr