ID: 911925801

View in Genome Browser
Species Human (GRCh38)
Location 1:103830829-103830851
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911925794_911925801 17 Left 911925794 1:103830789-103830811 CCACAAGCAGCCTGCAAACTGCT No data
Right 911925801 1:103830829-103830851 ACTGCCTGCCAAGGGGCTGGTGG No data
911925793_911925801 18 Left 911925793 1:103830788-103830810 CCCACAAGCAGCCTGCAAACTGC No data
Right 911925801 1:103830829-103830851 ACTGCCTGCCAAGGGGCTGGTGG No data
911925796_911925801 7 Left 911925796 1:103830799-103830821 CCTGCAAACTGCTTCAGGAATAC No data
Right 911925801 1:103830829-103830851 ACTGCCTGCCAAGGGGCTGGTGG No data
911925792_911925801 25 Left 911925792 1:103830781-103830803 CCTGGCTCCCACAAGCAGCCTGC No data
Right 911925801 1:103830829-103830851 ACTGCCTGCCAAGGGGCTGGTGG No data
911925789_911925801 30 Left 911925789 1:103830776-103830798 CCCACCCTGGCTCCCACAAGCAG No data
Right 911925801 1:103830829-103830851 ACTGCCTGCCAAGGGGCTGGTGG No data
911925791_911925801 26 Left 911925791 1:103830780-103830802 CCCTGGCTCCCACAAGCAGCCTG No data
Right 911925801 1:103830829-103830851 ACTGCCTGCCAAGGGGCTGGTGG No data
911925790_911925801 29 Left 911925790 1:103830777-103830799 CCACCCTGGCTCCCACAAGCAGC No data
Right 911925801 1:103830829-103830851 ACTGCCTGCCAAGGGGCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr