ID: 911927291

View in Genome Browser
Species Human (GRCh38)
Location 1:103851031-103851053
Sequence ATATTACCCTTTAAGTTCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911927289_911927291 30 Left 911927289 1:103850978-103851000 CCAGAGCAAAGAAAACAATGAAA No data
Right 911927291 1:103851031-103851053 ATATTACCCTTTAAGTTCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911927291 Original CRISPR ATATTACCCTTTAAGTTCTA GGG Intergenic
No off target data available for this crispr