ID: 911936581

View in Genome Browser
Species Human (GRCh38)
Location 1:103983039-103983061
Sequence TTAGATATGAATGTGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911936578_911936581 30 Left 911936578 1:103982986-103983008 CCGGTAATTTTAGAGATTTGGTA No data
Right 911936581 1:103983039-103983061 TTAGATATGAATGTGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911936581 Original CRISPR TTAGATATGAATGTGGAGGA AGG Intergenic
No off target data available for this crispr