ID: 911942859

View in Genome Browser
Species Human (GRCh38)
Location 1:104069513-104069535
Sequence AGAGAGAGTGCAATGACTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911942859_911942868 30 Left 911942859 1:104069513-104069535 CCCCCAGTCATTGCACTCTCTCT No data
Right 911942868 1:104069566-104069588 TGTGCTGCATGGTCACTGATGGG No data
911942859_911942865 19 Left 911942859 1:104069513-104069535 CCCCCAGTCATTGCACTCTCTCT No data
Right 911942865 1:104069555-104069577 TATCTCCTTTCTGTGCTGCATGG No data
911942859_911942867 29 Left 911942859 1:104069513-104069535 CCCCCAGTCATTGCACTCTCTCT No data
Right 911942867 1:104069565-104069587 CTGTGCTGCATGGTCACTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911942859 Original CRISPR AGAGAGAGTGCAATGACTGG GGG (reversed) Intergenic
No off target data available for this crispr