ID: 911948527

View in Genome Browser
Species Human (GRCh38)
Location 1:104141151-104141173
Sequence AAGACGCTTGTCTTCTCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911948524_911948527 3 Left 911948524 1:104141125-104141147 CCTGATTGTAATTTTCTGCCAAA No data
Right 911948527 1:104141151-104141173 AAGACGCTTGTCTTCTCAGGTGG No data
911948522_911948527 28 Left 911948522 1:104141100-104141122 CCAGCTTTAGACTTAATGAGTGG No data
Right 911948527 1:104141151-104141173 AAGACGCTTGTCTTCTCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911948527 Original CRISPR AAGACGCTTGTCTTCTCAGG TGG Intergenic
No off target data available for this crispr