ID: 911951457

View in Genome Browser
Species Human (GRCh38)
Location 1:104178095-104178117
Sequence CTGAATATTCACAAGAACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911951457_911951459 24 Left 911951457 1:104178095-104178117 CCATTGTTCTTGTGAATATTCAG No data
Right 911951459 1:104178142-104178164 TTAGTTTGCTTTGTGCACTTAGG No data
911951457_911951458 -2 Left 911951457 1:104178095-104178117 CCATTGTTCTTGTGAATATTCAG No data
Right 911951458 1:104178116-104178138 AGAATATATTCTTGAGTAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911951457 Original CRISPR CTGAATATTCACAAGAACAA TGG (reversed) Intergenic
No off target data available for this crispr