ID: 911953671

View in Genome Browser
Species Human (GRCh38)
Location 1:104209360-104209382
Sequence TCCCCAAACCTTGTATCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911953669_911953671 -9 Left 911953669 1:104209346-104209368 CCATAGTCACATCCTCCCCAAAC No data
Right 911953671 1:104209360-104209382 TCCCCAAACCTTGTATCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911953671 Original CRISPR TCCCCAAACCTTGTATCCAC TGG Intergenic
No off target data available for this crispr