ID: 911960505

View in Genome Browser
Species Human (GRCh38)
Location 1:104296210-104296232
Sequence CAGTTGGCATGAGGGGCATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911960505_911960513 11 Left 911960505 1:104296210-104296232 CCTTATGCCCCTCATGCCAACTG No data
Right 911960513 1:104296244-104296266 GAGGCAAGAATTGAGGTTGCTGG No data
911960505_911960512 4 Left 911960505 1:104296210-104296232 CCTTATGCCCCTCATGCCAACTG No data
Right 911960512 1:104296237-104296259 TTGTAAGGAGGCAAGAATTGAGG No data
911960505_911960510 -8 Left 911960505 1:104296210-104296232 CCTTATGCCCCTCATGCCAACTG No data
Right 911960510 1:104296225-104296247 GCCAACTGTTTCTTGTAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911960505 Original CRISPR CAGTTGGCATGAGGGGCATA AGG (reversed) Intergenic
No off target data available for this crispr