ID: 911960846

View in Genome Browser
Species Human (GRCh38)
Location 1:104300915-104300937
Sequence AGGGAGGGTGCAGTGACTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911960828_911960846 25 Left 911960828 1:104300867-104300889 CCCCATCCCCCCGCAGTGACACG No data
Right 911960846 1:104300915-104300937 AGGGAGGGTGCAGTGACTGAAGG No data
911960835_911960846 16 Left 911960835 1:104300876-104300898 CCCGCAGTGACACGGAGAGACAA No data
Right 911960846 1:104300915-104300937 AGGGAGGGTGCAGTGACTGAAGG No data
911960836_911960846 15 Left 911960836 1:104300877-104300899 CCGCAGTGACACGGAGAGACAAT No data
Right 911960846 1:104300915-104300937 AGGGAGGGTGCAGTGACTGAAGG No data
911960832_911960846 19 Left 911960832 1:104300873-104300895 CCCCCCGCAGTGACACGGAGAGA No data
Right 911960846 1:104300915-104300937 AGGGAGGGTGCAGTGACTGAAGG No data
911960829_911960846 24 Left 911960829 1:104300868-104300890 CCCATCCCCCCGCAGTGACACGG No data
Right 911960846 1:104300915-104300937 AGGGAGGGTGCAGTGACTGAAGG No data
911960826_911960846 29 Left 911960826 1:104300863-104300885 CCTCCCCCATCCCCCCGCAGTGA No data
Right 911960846 1:104300915-104300937 AGGGAGGGTGCAGTGACTGAAGG No data
911960825_911960846 30 Left 911960825 1:104300862-104300884 CCCTCCCCCATCCCCCCGCAGTG No data
Right 911960846 1:104300915-104300937 AGGGAGGGTGCAGTGACTGAAGG No data
911960827_911960846 26 Left 911960827 1:104300866-104300888 CCCCCATCCCCCCGCAGTGACAC No data
Right 911960846 1:104300915-104300937 AGGGAGGGTGCAGTGACTGAAGG No data
911960831_911960846 23 Left 911960831 1:104300869-104300891 CCATCCCCCCGCAGTGACACGGA No data
Right 911960846 1:104300915-104300937 AGGGAGGGTGCAGTGACTGAAGG No data
911960833_911960846 18 Left 911960833 1:104300874-104300896 CCCCCGCAGTGACACGGAGAGAC No data
Right 911960846 1:104300915-104300937 AGGGAGGGTGCAGTGACTGAAGG No data
911960834_911960846 17 Left 911960834 1:104300875-104300897 CCCCGCAGTGACACGGAGAGACA No data
Right 911960846 1:104300915-104300937 AGGGAGGGTGCAGTGACTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911960846 Original CRISPR AGGGAGGGTGCAGTGACTGA AGG Intergenic
No off target data available for this crispr