ID: 911965327

View in Genome Browser
Species Human (GRCh38)
Location 1:104361353-104361375
Sequence TAGTGGTGATGAGCTCTTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911965327_911965331 28 Left 911965327 1:104361353-104361375 CCTAAAAGAGCTCATCACCACTA No data
Right 911965331 1:104361404-104361426 AATTATTCAATTAAAAATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911965327 Original CRISPR TAGTGGTGATGAGCTCTTTT AGG (reversed) Intergenic
No off target data available for this crispr