ID: 911973357

View in Genome Browser
Species Human (GRCh38)
Location 1:104463726-104463748
Sequence AAAGGCCTGTTGAACTCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911973357_911973364 9 Left 911973357 1:104463726-104463748 CCCCCTGAGTTCAACAGGCCTTT No data
Right 911973364 1:104463758-104463780 TAATGCCCCATGCACTTGGAGGG 0: 4
1: 14
2: 18
3: 31
4: 109
911973357_911973362 5 Left 911973357 1:104463726-104463748 CCCCCTGAGTTCAACAGGCCTTT No data
Right 911973362 1:104463754-104463776 TGTATAATGCCCCATGCACTTGG 0: 5
1: 5
2: 13
3: 18
4: 93
911973357_911973363 8 Left 911973357 1:104463726-104463748 CCCCCTGAGTTCAACAGGCCTTT No data
Right 911973363 1:104463757-104463779 ATAATGCCCCATGCACTTGGAGG 0: 4
1: 15
2: 20
3: 28
4: 107
911973357_911973368 18 Left 911973357 1:104463726-104463748 CCCCCTGAGTTCAACAGGCCTTT No data
Right 911973368 1:104463767-104463789 ATGCACTTGGAGGGTTAAAAAGG 0: 6
1: 30
2: 20
3: 28
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911973357 Original CRISPR AAAGGCCTGTTGAACTCAGG GGG (reversed) Intergenic
No off target data available for this crispr