ID: 911974648

View in Genome Browser
Species Human (GRCh38)
Location 1:104476588-104476610
Sequence GGCTGGATTACTGAAAATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911974643_911974648 24 Left 911974643 1:104476541-104476563 CCCAAAACTAGATGAGATATCTG No data
Right 911974648 1:104476588-104476610 GGCTGGATTACTGAAAATTGAGG No data
911974642_911974648 25 Left 911974642 1:104476540-104476562 CCCCAAAACTAGATGAGATATCT No data
Right 911974648 1:104476588-104476610 GGCTGGATTACTGAAAATTGAGG No data
911974644_911974648 23 Left 911974644 1:104476542-104476564 CCAAAACTAGATGAGATATCTGA No data
Right 911974648 1:104476588-104476610 GGCTGGATTACTGAAAATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911974648 Original CRISPR GGCTGGATTACTGAAAATTG AGG Intergenic
No off target data available for this crispr