ID: 911974753

View in Genome Browser
Species Human (GRCh38)
Location 1:104477703-104477725
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911974750_911974753 10 Left 911974750 1:104477670-104477692 CCAAGACTTTGCTATTGTGAGAC No data
Right 911974753 1:104477703-104477725 TTATCTGGTCACAAATTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr