ID: 911981897

View in Genome Browser
Species Human (GRCh38)
Location 1:104579226-104579248
Sequence GAAAACTCTTGGCCTGTTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911981897_911981899 11 Left 911981897 1:104579226-104579248 CCAATAACAGGCCAAGAGTTTTC No data
Right 911981899 1:104579260-104579282 GAGTAGTTATCTGCAAAGTATGG No data
911981897_911981900 15 Left 911981897 1:104579226-104579248 CCAATAACAGGCCAAGAGTTTTC No data
Right 911981900 1:104579264-104579286 AGTTATCTGCAAAGTATGGCAGG No data
911981897_911981901 16 Left 911981897 1:104579226-104579248 CCAATAACAGGCCAAGAGTTTTC No data
Right 911981901 1:104579265-104579287 GTTATCTGCAAAGTATGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911981897 Original CRISPR GAAAACTCTTGGCCTGTTAT TGG (reversed) Intergenic
No off target data available for this crispr