ID: 911981900

View in Genome Browser
Species Human (GRCh38)
Location 1:104579264-104579286
Sequence AGTTATCTGCAAAGTATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911981894_911981900 25 Left 911981894 1:104579216-104579238 CCACCAAAGCCCAATAACAGGCC No data
Right 911981900 1:104579264-104579286 AGTTATCTGCAAAGTATGGCAGG No data
911981895_911981900 22 Left 911981895 1:104579219-104579241 CCAAAGCCCAATAACAGGCCAAG No data
Right 911981900 1:104579264-104579286 AGTTATCTGCAAAGTATGGCAGG No data
911981897_911981900 15 Left 911981897 1:104579226-104579248 CCAATAACAGGCCAAGAGTTTTC No data
Right 911981900 1:104579264-104579286 AGTTATCTGCAAAGTATGGCAGG No data
911981898_911981900 4 Left 911981898 1:104579237-104579259 CCAAGAGTTTTCTCTCAAAAAGA No data
Right 911981900 1:104579264-104579286 AGTTATCTGCAAAGTATGGCAGG No data
911981896_911981900 16 Left 911981896 1:104579225-104579247 CCCAATAACAGGCCAAGAGTTTT No data
Right 911981900 1:104579264-104579286 AGTTATCTGCAAAGTATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911981900 Original CRISPR AGTTATCTGCAAAGTATGGC AGG Intergenic
No off target data available for this crispr