ID: 911986491

View in Genome Browser
Species Human (GRCh38)
Location 1:104632081-104632103
Sequence GTTTACACACTGTCATATTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911986491_911986494 10 Left 911986491 1:104632081-104632103 CCTAAATATGACAGTGTGTAAAC No data
Right 911986494 1:104632114-104632136 ATAAAACAAATAGATGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911986491 Original CRISPR GTTTACACACTGTCATATTT AGG (reversed) Intergenic
No off target data available for this crispr