ID: 911988719

View in Genome Browser
Species Human (GRCh38)
Location 1:104664086-104664108
Sequence CACACGGCAGGGTACTCCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911988719_911988736 29 Left 911988719 1:104664086-104664108 CCATTGGAGTACCCTGCCGTGTG No data
Right 911988736 1:104664138-104664160 CCTCCCAGTTAGGCTGCTCGGGG No data
911988719_911988725 1 Left 911988719 1:104664086-104664108 CCATTGGAGTACCCTGCCGTGTG No data
Right 911988725 1:104664110-104664132 GGTGTCTGTGTGCCCCTGCTGGG No data
911988719_911988726 2 Left 911988719 1:104664086-104664108 CCATTGGAGTACCCTGCCGTGTG No data
Right 911988726 1:104664111-104664133 GTGTCTGTGTGCCCCTGCTGGGG No data
911988719_911988728 4 Left 911988719 1:104664086-104664108 CCATTGGAGTACCCTGCCGTGTG No data
Right 911988728 1:104664113-104664135 GTCTGTGTGCCCCTGCTGGGGGG No data
911988719_911988724 0 Left 911988719 1:104664086-104664108 CCATTGGAGTACCCTGCCGTGTG No data
Right 911988724 1:104664109-104664131 AGGTGTCTGTGTGCCCCTGCTGG No data
911988719_911988732 19 Left 911988719 1:104664086-104664108 CCATTGGAGTACCCTGCCGTGTG No data
Right 911988732 1:104664128-104664150 CTGGGGGGTGCCTCCCAGTTAGG No data
911988719_911988733 27 Left 911988719 1:104664086-104664108 CCATTGGAGTACCCTGCCGTGTG No data
Right 911988733 1:104664136-104664158 TGCCTCCCAGTTAGGCTGCTCGG No data
911988719_911988734 28 Left 911988719 1:104664086-104664108 CCATTGGAGTACCCTGCCGTGTG No data
Right 911988734 1:104664137-104664159 GCCTCCCAGTTAGGCTGCTCGGG No data
911988719_911988727 3 Left 911988719 1:104664086-104664108 CCATTGGAGTACCCTGCCGTGTG No data
Right 911988727 1:104664112-104664134 TGTCTGTGTGCCCCTGCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911988719 Original CRISPR CACACGGCAGGGTACTCCAA TGG (reversed) Intergenic