ID: 911989360

View in Genome Browser
Species Human (GRCh38)
Location 1:104672899-104672921
Sequence CATAGAGAAATGCCCACTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911989358_911989360 30 Left 911989358 1:104672846-104672868 CCTTTTTAAAAAAAAAAAAACTT 0: 2
1: 19
2: 455
3: 5359
4: 30436
Right 911989360 1:104672899-104672921 CATAGAGAAATGCCCACTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911989360 Original CRISPR CATAGAGAAATGCCCACTAT AGG Intergenic
No off target data available for this crispr