ID: 912006662

View in Genome Browser
Species Human (GRCh38)
Location 1:104911486-104911508
Sequence CTGGTGACCAAGAGTGACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912006660_912006662 -1 Left 912006660 1:104911464-104911486 CCAAGGATAAGTAAGGTCAGAGC No data
Right 912006662 1:104911486-104911508 CTGGTGACCAAGAGTGACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912006662 Original CRISPR CTGGTGACCAAGAGTGACCA AGG Intergenic
No off target data available for this crispr