ID: 912010067

View in Genome Browser
Species Human (GRCh38)
Location 1:104948220-104948242
Sequence CCGGGCGTGCCCGTCTCTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912010061_912010067 -8 Left 912010061 1:104948205-104948227 CCTATAATCAGCCCCCCGGGCGT No data
Right 912010067 1:104948220-104948242 CCGGGCGTGCCCGTCTCTTATGG No data
912010058_912010067 6 Left 912010058 1:104948191-104948213 CCTGGAGGTATAGGCCTATAATC No data
Right 912010067 1:104948220-104948242 CCGGGCGTGCCCGTCTCTTATGG No data
912010052_912010067 28 Left 912010052 1:104948169-104948191 CCCCTGGGAAAGAGAATACAAGC No data
Right 912010067 1:104948220-104948242 CCGGGCGTGCCCGTCTCTTATGG No data
912010053_912010067 27 Left 912010053 1:104948170-104948192 CCCTGGGAAAGAGAATACAAGCC No data
Right 912010067 1:104948220-104948242 CCGGGCGTGCCCGTCTCTTATGG No data
912010054_912010067 26 Left 912010054 1:104948171-104948193 CCTGGGAAAGAGAATACAAGCCT No data
Right 912010067 1:104948220-104948242 CCGGGCGTGCCCGTCTCTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912010067 Original CRISPR CCGGGCGTGCCCGTCTCTTA TGG Intergenic
No off target data available for this crispr