ID: 912010923

View in Genome Browser
Species Human (GRCh38)
Location 1:104961299-104961321
Sequence TGCTCTATTAAAATAAATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912010921_912010923 9 Left 912010921 1:104961267-104961289 CCTTTCACTGAAATTTACTGTGA No data
Right 912010923 1:104961299-104961321 TGCTCTATTAAAATAAATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912010923 Original CRISPR TGCTCTATTAAAATAAATGA AGG Intergenic
No off target data available for this crispr