ID: 912011183

View in Genome Browser
Species Human (GRCh38)
Location 1:104965463-104965485
Sequence AAAGTATACTAGACCATGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912011179_912011183 12 Left 912011179 1:104965428-104965450 CCTAGTGTGTTCAAGAACTGGGG No data
Right 912011183 1:104965463-104965485 AAAGTATACTAGACCATGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912011183 Original CRISPR AAAGTATACTAGACCATGTA AGG Intergenic
No off target data available for this crispr