ID: 912012751

View in Genome Browser
Species Human (GRCh38)
Location 1:104989756-104989778
Sequence TTTTACCTAGCAGTCACTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912012751_912012755 30 Left 912012751 1:104989756-104989778 CCCACAGTGACTGCTAGGTAAAA No data
Right 912012755 1:104989809-104989831 TATCAAGGACTTCGTATTTGTGG No data
912012751_912012754 15 Left 912012751 1:104989756-104989778 CCCACAGTGACTGCTAGGTAAAA No data
Right 912012754 1:104989794-104989816 GAATTTAAACAGAGGTATCAAGG No data
912012751_912012753 7 Left 912012751 1:104989756-104989778 CCCACAGTGACTGCTAGGTAAAA No data
Right 912012753 1:104989786-104989808 CAAAAACAGAATTTAAACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912012751 Original CRISPR TTTTACCTAGCAGTCACTGT GGG (reversed) Intergenic
No off target data available for this crispr