ID: 912012752

View in Genome Browser
Species Human (GRCh38)
Location 1:104989757-104989779
Sequence GTTTTACCTAGCAGTCACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912012752_912012755 29 Left 912012752 1:104989757-104989779 CCACAGTGACTGCTAGGTAAAAC No data
Right 912012755 1:104989809-104989831 TATCAAGGACTTCGTATTTGTGG No data
912012752_912012754 14 Left 912012752 1:104989757-104989779 CCACAGTGACTGCTAGGTAAAAC No data
Right 912012754 1:104989794-104989816 GAATTTAAACAGAGGTATCAAGG No data
912012752_912012753 6 Left 912012752 1:104989757-104989779 CCACAGTGACTGCTAGGTAAAAC No data
Right 912012753 1:104989786-104989808 CAAAAACAGAATTTAAACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912012752 Original CRISPR GTTTTACCTAGCAGTCACTG TGG (reversed) Intergenic
No off target data available for this crispr