ID: 912012754

View in Genome Browser
Species Human (GRCh38)
Location 1:104989794-104989816
Sequence GAATTTAAACAGAGGTATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912012752_912012754 14 Left 912012752 1:104989757-104989779 CCACAGTGACTGCTAGGTAAAAC No data
Right 912012754 1:104989794-104989816 GAATTTAAACAGAGGTATCAAGG No data
912012751_912012754 15 Left 912012751 1:104989756-104989778 CCCACAGTGACTGCTAGGTAAAA No data
Right 912012754 1:104989794-104989816 GAATTTAAACAGAGGTATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912012754 Original CRISPR GAATTTAAACAGAGGTATCA AGG Intergenic
No off target data available for this crispr