ID: 912012754 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:104989794-104989816 |
Sequence | GAATTTAAACAGAGGTATCA AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
912012752_912012754 | 14 | Left | 912012752 | 1:104989757-104989779 | CCACAGTGACTGCTAGGTAAAAC | No data | ||
Right | 912012754 | 1:104989794-104989816 | GAATTTAAACAGAGGTATCAAGG | No data | ||||
912012751_912012754 | 15 | Left | 912012751 | 1:104989756-104989778 | CCCACAGTGACTGCTAGGTAAAA | No data | ||
Right | 912012754 | 1:104989794-104989816 | GAATTTAAACAGAGGTATCAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
912012754 | Original CRISPR | GAATTTAAACAGAGGTATCA AGG | Intergenic | ||
No off target data available for this crispr |