ID: 912015999

View in Genome Browser
Species Human (GRCh38)
Location 1:105036405-105036427
Sequence TCTGATATGAAGCTATTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912015999_912016001 5 Left 912015999 1:105036405-105036427 CCATTCAATAGCTTCATATCAGA No data
Right 912016001 1:105036433-105036455 AAACAAATTGTTCACATAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912015999 Original CRISPR TCTGATATGAAGCTATTGAA TGG (reversed) Intergenic
No off target data available for this crispr