ID: 912017385

View in Genome Browser
Species Human (GRCh38)
Location 1:105059099-105059121
Sequence CTGTGGCATACACTGTTTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912017377_912017385 11 Left 912017377 1:105059065-105059087 CCTTCTGGGGTAAGGGGAACCCA No data
Right 912017385 1:105059099-105059121 CTGTGGCATACACTGTTTAGGGG No data
912017372_912017385 21 Left 912017372 1:105059055-105059077 CCAACCTCAGCCTTCTGGGGTAA No data
Right 912017385 1:105059099-105059121 CTGTGGCATACACTGTTTAGGGG No data
912017381_912017385 -8 Left 912017381 1:105059084-105059106 CCCAGGAATCAGAGGCTGTGGCA No data
Right 912017385 1:105059099-105059121 CTGTGGCATACACTGTTTAGGGG No data
912017382_912017385 -9 Left 912017382 1:105059085-105059107 CCAGGAATCAGAGGCTGTGGCAT No data
Right 912017385 1:105059099-105059121 CTGTGGCATACACTGTTTAGGGG No data
912017375_912017385 17 Left 912017375 1:105059059-105059081 CCTCAGCCTTCTGGGGTAAGGGG No data
Right 912017385 1:105059099-105059121 CTGTGGCATACACTGTTTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912017385 Original CRISPR CTGTGGCATACACTGTTTAG GGG Intergenic
No off target data available for this crispr