ID: 912018548

View in Genome Browser
Species Human (GRCh38)
Location 1:105072980-105073002
Sequence AGGAAGAGTGCAGTGACTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912018548_912018554 25 Left 912018548 1:105072980-105073002 CCCTCAGTCACTGCACTCTTCCT No data
Right 912018554 1:105073028-105073050 CACTACATGGCTGCTGCCAGTGG No data
912018548_912018555 29 Left 912018548 1:105072980-105073002 CCCTCAGTCACTGCACTCTTCCT No data
Right 912018555 1:105073032-105073054 ACATGGCTGCTGCCAGTGGATGG No data
912018548_912018553 12 Left 912018548 1:105072980-105073002 CCCTCAGTCACTGCACTCTTCCT No data
Right 912018553 1:105073015-105073037 GACTCTTTCTCTGCACTACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912018548 Original CRISPR AGGAAGAGTGCAGTGACTGA GGG (reversed) Intergenic
No off target data available for this crispr