ID: 912020363

View in Genome Browser
Species Human (GRCh38)
Location 1:105101640-105101662
Sequence AACTGCCTTGTCATCTCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912020359_912020363 20 Left 912020359 1:105101597-105101619 CCCTCGTTTTTATTTTCCTTTCT No data
Right 912020363 1:105101640-105101662 AACTGCCTTGTCATCTCTGGTGG No data
912020360_912020363 19 Left 912020360 1:105101598-105101620 CCTCGTTTTTATTTTCCTTTCTC No data
Right 912020363 1:105101640-105101662 AACTGCCTTGTCATCTCTGGTGG No data
912020361_912020363 4 Left 912020361 1:105101613-105101635 CCTTTCTCAGTAACAACAGCAAA No data
Right 912020363 1:105101640-105101662 AACTGCCTTGTCATCTCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912020363 Original CRISPR AACTGCCTTGTCATCTCTGG TGG Intergenic
No off target data available for this crispr