ID: 912022538

View in Genome Browser
Species Human (GRCh38)
Location 1:105123150-105123172
Sequence TATTATCTTTATATGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912022531_912022538 26 Left 912022531 1:105123101-105123123 CCAAGTACAAGGCACCAATATCT No data
Right 912022538 1:105123150-105123172 TATTATCTTTATATGGTGGAAGG No data
912022534_912022538 12 Left 912022534 1:105123115-105123137 CCAATATCTGGTGTTTGGTGAGA No data
Right 912022538 1:105123150-105123172 TATTATCTTTATATGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912022538 Original CRISPR TATTATCTTTATATGGTGGA AGG Intergenic
No off target data available for this crispr