ID: 912026097

View in Genome Browser
Species Human (GRCh38)
Location 1:105175499-105175521
Sequence TCACTACTCTTCCCAGACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912026092_912026097 24 Left 912026092 1:105175452-105175474 CCAACCACTAGATCTTATTCTGT No data
Right 912026097 1:105175499-105175521 TCACTACTCTTCCCAGACACTGG No data
912026093_912026097 20 Left 912026093 1:105175456-105175478 CCACTAGATCTTATTCTGTGTAT No data
Right 912026097 1:105175499-105175521 TCACTACTCTTCCCAGACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912026097 Original CRISPR TCACTACTCTTCCCAGACAC TGG Intergenic
No off target data available for this crispr