ID: 912042341

View in Genome Browser
Species Human (GRCh38)
Location 1:105408252-105408274
Sequence AGGTTGTTGTAGATGTTAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912042334_912042341 21 Left 912042334 1:105408208-105408230 CCCTACAACCTCAGAATGTAACC No data
Right 912042341 1:105408252-105408274 AGGTTGTTGTAGATGTTAGATGG No data
912042339_912042341 0 Left 912042339 1:105408229-105408251 CCTTATTTGGAAATAAGGTTGTT No data
Right 912042341 1:105408252-105408274 AGGTTGTTGTAGATGTTAGATGG No data
912042335_912042341 20 Left 912042335 1:105408209-105408231 CCTACAACCTCAGAATGTAACCT No data
Right 912042341 1:105408252-105408274 AGGTTGTTGTAGATGTTAGATGG No data
912042336_912042341 13 Left 912042336 1:105408216-105408238 CCTCAGAATGTAACCTTATTTGG 0: 32
1: 435
2: 1043
3: 2009
4: 2895
Right 912042341 1:105408252-105408274 AGGTTGTTGTAGATGTTAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912042341 Original CRISPR AGGTTGTTGTAGATGTTAGA TGG Intergenic
No off target data available for this crispr