ID: 912043834

View in Genome Browser
Species Human (GRCh38)
Location 1:105427861-105427883
Sequence GGCTGGGTCAGTGAAAATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912043827_912043834 12 Left 912043827 1:105427826-105427848 CCCTTATACCTACTTTCAATTAC No data
Right 912043834 1:105427861-105427883 GGCTGGGTCAGTGAAAATTGAGG No data
912043829_912043834 4 Left 912043829 1:105427834-105427856 CCTACTTTCAATTACATGCAAAA No data
Right 912043834 1:105427861-105427883 GGCTGGGTCAGTGAAAATTGAGG No data
912043828_912043834 11 Left 912043828 1:105427827-105427849 CCTTATACCTACTTTCAATTACA No data
Right 912043834 1:105427861-105427883 GGCTGGGTCAGTGAAAATTGAGG No data
912043826_912043834 29 Left 912043826 1:105427809-105427831 CCAGTTGTATTTATACTCCCTTA No data
Right 912043834 1:105427861-105427883 GGCTGGGTCAGTGAAAATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912043834 Original CRISPR GGCTGGGTCAGTGAAAATTG AGG Intergenic
No off target data available for this crispr