ID: 912050675

View in Genome Browser
Species Human (GRCh38)
Location 1:105524911-105524933
Sequence GATAACTCTTGGCCTATTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912050675_912050677 11 Left 912050675 1:105524911-105524933 CCAGTAATAGGCCAAGAGTTATC No data
Right 912050677 1:105524945-105524967 AAGTAGTTATCTGCAGATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912050675 Original CRISPR GATAACTCTTGGCCTATTAC TGG (reversed) Intergenic
No off target data available for this crispr