ID: 912067021

View in Genome Browser
Species Human (GRCh38)
Location 1:105756945-105756967
Sequence AGTTATATGCAGAAGAAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912067021_912067028 26 Left 912067021 1:105756945-105756967 CCTGCCTTCTTCTGCATATAACT No data
Right 912067028 1:105756994-105757016 GCCTGTTACTGGGTTGGTACAGG No data
912067021_912067027 20 Left 912067021 1:105756945-105756967 CCTGCCTTCTTCTGCATATAACT No data
Right 912067027 1:105756988-105757010 CTCTTGGCCTGTTACTGGGTTGG No data
912067021_912067023 4 Left 912067021 1:105756945-105756967 CCTGCCTTCTTCTGCATATAACT No data
Right 912067023 1:105756972-105756994 TTCCTTTAAGAGACAGCTCTTGG No data
912067021_912067030 30 Left 912067021 1:105756945-105756967 CCTGCCTTCTTCTGCATATAACT No data
Right 912067030 1:105756998-105757020 GTTACTGGGTTGGTACAGGTTGG No data
912067021_912067025 15 Left 912067021 1:105756945-105756967 CCTGCCTTCTTCTGCATATAACT No data
Right 912067025 1:105756983-105757005 GACAGCTCTTGGCCTGTTACTGG 0: 162
1: 189
2: 129
3: 114
4: 178
912067021_912067026 16 Left 912067021 1:105756945-105756967 CCTGCCTTCTTCTGCATATAACT No data
Right 912067026 1:105756984-105757006 ACAGCTCTTGGCCTGTTACTGGG 0: 174
1: 194
2: 145
3: 123
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912067021 Original CRISPR AGTTATATGCAGAAGAAGGC AGG (reversed) Intergenic
No off target data available for this crispr