ID: 912067023

View in Genome Browser
Species Human (GRCh38)
Location 1:105756972-105756994
Sequence TTCCTTTAAGAGACAGCTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912067020_912067023 5 Left 912067020 1:105756944-105756966 CCCTGCCTTCTTCTGCATATAAC No data
Right 912067023 1:105756972-105756994 TTCCTTTAAGAGACAGCTCTTGG No data
912067021_912067023 4 Left 912067021 1:105756945-105756967 CCTGCCTTCTTCTGCATATAACT No data
Right 912067023 1:105756972-105756994 TTCCTTTAAGAGACAGCTCTTGG No data
912067022_912067023 0 Left 912067022 1:105756949-105756971 CCTTCTTCTGCATATAACTACTC No data
Right 912067023 1:105756972-105756994 TTCCTTTAAGAGACAGCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912067023 Original CRISPR TTCCTTTAAGAGACAGCTCT TGG Intergenic
No off target data available for this crispr