ID: 912067027

View in Genome Browser
Species Human (GRCh38)
Location 1:105756988-105757010
Sequence CTCTTGGCCTGTTACTGGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912067021_912067027 20 Left 912067021 1:105756945-105756967 CCTGCCTTCTTCTGCATATAACT No data
Right 912067027 1:105756988-105757010 CTCTTGGCCTGTTACTGGGTTGG No data
912067020_912067027 21 Left 912067020 1:105756944-105756966 CCCTGCCTTCTTCTGCATATAAC No data
Right 912067027 1:105756988-105757010 CTCTTGGCCTGTTACTGGGTTGG No data
912067024_912067027 -9 Left 912067024 1:105756974-105756996 CCTTTAAGAGACAGCTCTTGGCC No data
Right 912067027 1:105756988-105757010 CTCTTGGCCTGTTACTGGGTTGG No data
912067022_912067027 16 Left 912067022 1:105756949-105756971 CCTTCTTCTGCATATAACTACTC No data
Right 912067027 1:105756988-105757010 CTCTTGGCCTGTTACTGGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912067027 Original CRISPR CTCTTGGCCTGTTACTGGGT TGG Intergenic
No off target data available for this crispr