ID: 912067030

View in Genome Browser
Species Human (GRCh38)
Location 1:105756998-105757020
Sequence GTTACTGGGTTGGTACAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912067024_912067030 1 Left 912067024 1:105756974-105756996 CCTTTAAGAGACAGCTCTTGGCC No data
Right 912067030 1:105756998-105757020 GTTACTGGGTTGGTACAGGTTGG No data
912067021_912067030 30 Left 912067021 1:105756945-105756967 CCTGCCTTCTTCTGCATATAACT No data
Right 912067030 1:105756998-105757020 GTTACTGGGTTGGTACAGGTTGG No data
912067022_912067030 26 Left 912067022 1:105756949-105756971 CCTTCTTCTGCATATAACTACTC No data
Right 912067030 1:105756998-105757020 GTTACTGGGTTGGTACAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912067030 Original CRISPR GTTACTGGGTTGGTACAGGT TGG Intergenic
No off target data available for this crispr