ID: 912067519

View in Genome Browser
Species Human (GRCh38)
Location 1:105762888-105762910
Sequence TCTACGGAGGAGAGGATGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912067510_912067519 -5 Left 912067510 1:105762870-105762892 CCACCCCTGCCTCAGACCTCTAC No data
Right 912067519 1:105762888-105762910 TCTACGGAGGAGAGGATGTATGG No data
912067513_912067519 -9 Left 912067513 1:105762874-105762896 CCCTGCCTCAGACCTCTACGGAG No data
Right 912067519 1:105762888-105762910 TCTACGGAGGAGAGGATGTATGG No data
912067509_912067519 26 Left 912067509 1:105762839-105762861 CCACTTAGTAAGGAAGCTTAAAC No data
Right 912067519 1:105762888-105762910 TCTACGGAGGAGAGGATGTATGG No data
912067514_912067519 -10 Left 912067514 1:105762875-105762897 CCTGCCTCAGACCTCTACGGAGG No data
Right 912067519 1:105762888-105762910 TCTACGGAGGAGAGGATGTATGG No data
912067512_912067519 -8 Left 912067512 1:105762873-105762895 CCCCTGCCTCAGACCTCTACGGA No data
Right 912067519 1:105762888-105762910 TCTACGGAGGAGAGGATGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912067519 Original CRISPR TCTACGGAGGAGAGGATGTA TGG Intergenic
No off target data available for this crispr