ID: 912068687

View in Genome Browser
Species Human (GRCh38)
Location 1:105779801-105779823
Sequence ACCAGGCAGTGCCCCAGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912068687_912068692 -6 Left 912068687 1:105779801-105779823 CCCTCACTGGGGCACTGCCTGGT No data
Right 912068692 1:105779818-105779840 CCTGGTGGAGCAGTGAAAGAGGG No data
912068687_912068694 20 Left 912068687 1:105779801-105779823 CCCTCACTGGGGCACTGCCTGGT No data
Right 912068694 1:105779844-105779866 TCATCTTCCAGACCCCAGAATGG No data
912068687_912068690 -7 Left 912068687 1:105779801-105779823 CCCTCACTGGGGCACTGCCTGGT No data
Right 912068690 1:105779817-105779839 GCCTGGTGGAGCAGTGAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912068687 Original CRISPR ACCAGGCAGTGCCCCAGTGA GGG (reversed) Intergenic