ID: 912068981

View in Genome Browser
Species Human (GRCh38)
Location 1:105783396-105783418
Sequence TTGTATACACATCTTTAGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912068978_912068981 14 Left 912068978 1:105783359-105783381 CCAAATAAGTTGACTTTCACAGA No data
Right 912068981 1:105783396-105783418 TTGTATACACATCTTTAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912068981 Original CRISPR TTGTATACACATCTTTAGTT TGG Intergenic
No off target data available for this crispr