ID: 912074284

View in Genome Browser
Species Human (GRCh38)
Location 1:105852476-105852498
Sequence TTTTAGTTGTTTATTGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912074284_912074288 24 Left 912074284 1:105852476-105852498 CCTGCAGCAATAAACAACTAAAA No data
Right 912074288 1:105852523-105852545 AAGTTTGGTTTTGTACACTGTGG No data
912074284_912074285 -7 Left 912074284 1:105852476-105852498 CCTGCAGCAATAAACAACTAAAA No data
Right 912074285 1:105852492-105852514 ACTAAAATATCAGATTTAAAAGG No data
912074284_912074286 1 Left 912074284 1:105852476-105852498 CCTGCAGCAATAAACAACTAAAA No data
Right 912074286 1:105852500-105852522 ATCAGATTTAAAAGGAAAAACGG No data
912074284_912074287 9 Left 912074284 1:105852476-105852498 CCTGCAGCAATAAACAACTAAAA No data
Right 912074287 1:105852508-105852530 TAAAAGGAAAAACGGAAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912074284 Original CRISPR TTTTAGTTGTTTATTGCTGC AGG (reversed) Intergenic
No off target data available for this crispr