ID: 912075824

View in Genome Browser
Species Human (GRCh38)
Location 1:105873778-105873800
Sequence CCTTCTCTTGACGGTGATTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912075812_912075824 22 Left 912075812 1:105873733-105873755 CCTCCCTCTCCTGATGTGTCTTT No data
Right 912075824 1:105873778-105873800 CCTTCTCTTGACGGTGATTGTGG No data
912075818_912075824 -9 Left 912075818 1:105873764-105873786 CCTGAGCTGCCCCACCTTCTCTT No data
Right 912075824 1:105873778-105873800 CCTTCTCTTGACGGTGATTGTGG No data
912075813_912075824 19 Left 912075813 1:105873736-105873758 CCCTCTCCTGATGTGTCTTTTTT No data
Right 912075824 1:105873778-105873800 CCTTCTCTTGACGGTGATTGTGG No data
912075814_912075824 18 Left 912075814 1:105873737-105873759 CCTCTCCTGATGTGTCTTTTTTG No data
Right 912075824 1:105873778-105873800 CCTTCTCTTGACGGTGATTGTGG No data
912075816_912075824 13 Left 912075816 1:105873742-105873764 CCTGATGTGTCTTTTTTGGCCGC No data
Right 912075824 1:105873778-105873800 CCTTCTCTTGACGGTGATTGTGG No data
912075817_912075824 -6 Left 912075817 1:105873761-105873783 CCGCCTGAGCTGCCCCACCTTCT No data
Right 912075824 1:105873778-105873800 CCTTCTCTTGACGGTGATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912075824 Original CRISPR CCTTCTCTTGACGGTGATTG TGG Intergenic
No off target data available for this crispr