ID: 912075827

View in Genome Browser
Species Human (GRCh38)
Location 1:105873810-105873832
Sequence CCTCGGTGTGGAGCAGAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912075827_912075832 27 Left 912075827 1:105873810-105873832 CCACTTTCTGCTCCACACCGAGG No data
Right 912075832 1:105873860-105873882 CAGACTTCACTCACTTTTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912075827 Original CRISPR CCTCGGTGTGGAGCAGAAAG TGG (reversed) Intergenic
No off target data available for this crispr